Melanargia occitanica

98769_580_360 80025_580_360 75269_580_360 49707_580_360 40490_580_360

Barcode data: melanargia occitanica 1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGTACCTCTCTTAGTCTTATTATTCGAACAGAATTAGGTAACCCAGGATTTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATCTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTCCCCCTTATATTAGGAGCTCCAGATATAGCTTTTCCACGTATAAACAATATAAGTTTTTGACTTTTACCCCCATCTTTAATATTATTAATTTCAAGCAGTATTGTCGAAAATGGAGCTGGAACTGGATGAACAGTTTACCCCCCTCTCTCAGCTAATATTGCCCATGGAGGATCATCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAGTTAATAATATATCTTATGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCTTTATTATTATTACTTTCTCTTCCTGTTTTAGCGGGAGCTATTACAATACTCCTAACAGATCGTAATCTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACACTTATTC
-- end --

Download FASTA File

Fuentes y Créditos

  1. (c) Barcode of Life Data Systems, algunos derechos reservados (CC BY), http://natusfera.gbif.es/guide_taxa/420

Más Información